View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_high_93 (Length: 242)
Name: NF11703_high_93
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_high_93 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 838844 - 839068
Alignment:
| Q |
19 |
caattatcaccatgtttctctatattaacaaattgttgtttgtttatttattcataaaaaccgattccttcttttcaaattgattttattattataactg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
838844 |
caattatcaccatgtttctctatattaacaaattgttgtttgtttatttattcataaaaactgattccttcttttcaaattgattttattattataaccg |
838943 |
T |
 |
| Q |
119 |
tttagtagtatactcccctctgatctcaaatataaacattggttaaagaaaattgattct-aactagtacataatttgaaaaattcatttttgaattgaa |
217 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
838944 |
tttagtagtatactccgcactgatctcaaatataaacattggttaaagaaatttgattctaaactagtacataatttgaaaaattcatttttgaattgaa |
839043 |
T |
 |
| Q |
218 |
agtattgaaactcattaagattaac |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
839044 |
agtattgaaactcattaagattaac |
839068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University