View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_102 (Length: 235)
Name: NF11703_low_102
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 54016914 - 54016700
Alignment:
| Q |
18 |
gattttgccatcttc-atattaatagatttgattttgactctaaagttgattacttatttaaagttaagatttatagtttatgactctcaacatagtaaa |
116 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
54016914 |
gattttgccatattctatattaatagatttgattttgactctaaagttgattacttatttaaagttaagatttatagtttttgactctcaacatacaaaa |
54016815 |
T |
 |
| Q |
117 |
ttatatacttggatcaaatttcccttaagaagaatcttccaatttactccttcaccattctatttctgcccaattgcaaccaaagtgtccacccctgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54016814 |
ttatatacttggatcaaatttcccttaagaagaatcttccaaattactccttcaccatcctatttctgcccaattgcaaccaaagtgtccacccctgttt |
54016715 |
T |
 |
| Q |
217 |
tcatctctctcgacca |
232 |
Q |
| |
|
| |||| ||||||||| |
|
|
| T |
54016714 |
tgatct-tctcgacca |
54016700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University