View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_115 (Length: 218)
Name: NF11703_low_115
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_115 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 22098784 - 22098569
Alignment:
| Q |
1 |
ttcttcttcttcttcatcatcataatcgtcttcttctacttggtctttggttgcaggtgtagggacttggatacgatcgaatagtaatttctttggaatt |
100 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22098784 |
ttcttcttcatcatcatcatcataatcgtcttcttctacttggtctttggttgcaggtgtagggacttggatacgatcaaatagtaatttctttggaatt |
22098685 |
T |
 |
| Q |
101 |
ttcacctctcttgcattgccttgttcttcaagaaccaacttttgatccattttctttaaggctttgagaaatnnnnnnntttcatccctttctccacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22098684 |
ttcacctctcttgcattgccttgttcttcaagaaccaacttttgatccattttctttaaggctttgagaaatacaaatttttcatccctttctccacatt |
22098585 |
T |
 |
| Q |
201 |
ttcctttgcttctcct |
216 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
22098584 |
ttcctttgcatctcct |
22098569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University