View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_42 (Length: 386)
Name: NF11703_low_42
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 18 - 376
Target Start/End: Original strand, 45548629 - 45548987
Alignment:
| Q |
18 |
ccttgaatgtgcaatattctttggcgatctcatccagaagtatactaaggatatgcttttctgtatcccttataacatcatatttttcgataaatgcaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548629 |
ccttgaatgtgcaatattctttggcgatctcatccagaagtatactaaggatatgcttttctgtatcccttataacatcatatttttcgataaatgcaga |
45548728 |
T |
 |
| Q |
118 |
tgtctcatcattccaacctaaatcccacatgcaatctatgtcaggccatttttcgtagatatcatgctcaagcatcttaggcaggtagtcctcaacatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548729 |
tgtctcatcattccaacctaaatcccacatgcaatctatgtcaggccatttttcatagatatcatgctcaagcatcttaggcaggtagtcctcaacatca |
45548828 |
T |
 |
| Q |
218 |
actttgctactctttttccttccgtagaatttaatcttctccatgtcctcgttcagcttcttaaccaagtcatctagagatcttatcaagttaacagtac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548829 |
actttgctactctttttccttccgtagaatttaatcttctccatgtcctcgttcagcttcttaaccaagtcatctagagatcttatcaagttaacagtac |
45548928 |
T |
 |
| Q |
318 |
tagtgattgatgatatttttgaacaagtatgaattttgagttcctgccgtatccccttt |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45548929 |
tagtgattgatgatatttttgaacaagtatgaactttgagttcctgccgtatccccttt |
45548987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University