View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_48 (Length: 359)
Name: NF11703_low_48
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 181 - 344
Target Start/End: Original strand, 17257483 - 17257646
Alignment:
| Q |
181 |
tgccaacttagaacaggtgttacatgttcaacaagataatgtggaacctccccttgcgcagcaacaggaagaggtttttccgcaaggggattcagcaagg |
280 |
Q |
| |
|
||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17257483 |
tgccatcttagaaccggtgttacatgttcaataagataatgtggaacctccccttgcgcagcaacaggaagaggtttttccgcaaggggattcagcaagg |
17257582 |
T |
|
| Q |
281 |
ttagaaggtgcggctactttcaatgctactgccacactgcccgaacaacatccatttgcaactc |
344 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17257583 |
ttggaaggtgcggctactttcaatgctactgccacactgcccgaacagcatccatttgcaactc |
17257646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 169 - 343
Target Start/End: Original strand, 28668266 - 28668440
Alignment:
| Q |
169 |
tgtcgcaagcactgccaacttagaacaggtgttacatgttcaacaagataatgtggaacctccccttgcgcagcaacaggaagaggtttttccgcaaggg |
268 |
Q |
| |
|
||||||||||| |||| |||||||| || |||||||||||||||||||||||||||| ||||| |||||||| ||| |||||||| || |||||| | |
|
|
| T |
28668266 |
tgtcgcaagcatagccatcttagaaccagtattacatgttcaacaagataatgtggaacatccccctgcgcagctacatgaagaggtattgtcgcaagag |
28668365 |
T |
|
| Q |
269 |
gattcagcaaggttagaaggtgcggctactttcaatgctactgccacactgcccgaacaacatccatttgcaact |
343 |
Q |
| |
|
|||| ||||||| ||||||| ||| || |||| ||||||||||| ||| ||| ||||||| || |||||||| |
|
|
| T |
28668366 |
gatttgacaaggttggaaggtgtggcaaccttcactgctactgccaaacttcccaaacaacaccctcttgcaact |
28668440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University