View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_49 (Length: 354)
Name: NF11703_low_49
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 11 - 341
Target Start/End: Original strand, 3445302 - 3445631
Alignment:
| Q |
11 |
gcacagatcatcaattgggttggtttatgtcattttaatctttcttgttgtcttctgagtttagatgcatcatcatcacaaatttgcagtaggattcacg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3445302 |
gcacagatcatcaattgggttggtttatgtcattttaatctttcttgttgtcttttgagtttagatacatcatcatcacaaatttgcagtaggattcacg |
3445401 |
T |
|
| Q |
111 |
tgaatcagataatattattaatgttttagatatggtttttgttatgatgtatcttatcaacatgatgttgcatgtgtggattatgtcacaaaacatcctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3445402 |
tgaatcagataatattattaatgttttagatatggtttttgttatgatgtatgttatcaacatgatgttgcatgtgt-gattatgtcacaaaacatcctt |
3445500 |
T |
|
| Q |
211 |
tgccatctctttcatgaatctggtttgtgaaggattcttaatgttctttgaatctctgatggatgcaatttggaagagaaaaatgagaagnnnnnnngta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3445501 |
tgccatctctttcatgaatctggtttgtgaaggattcttaatgttctttgaatctctgatggatgcaatttggaagagaaaaatgagaagaaaaaaagta |
3445600 |
T |
|
| Q |
311 |
tggctgatatgataggaatcggttgtgattg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3445601 |
tggctgatatgataggaatcggttgtgattg |
3445631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University