View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11703_low_50 (Length: 352)

Name: NF11703_low_50
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11703_low_50
NF11703_low_50
[»] chr8 (2 HSPs)
chr8 (222-330)||(35607671-35607778)
chr8 (303-337)||(5663274-5663308)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 330
Target Start/End: Original strand, 35607671 - 35607778
Alignment:
222 ttgtgctactgttgttataattcatcgtcttctttgtttattttgctaatctgttagaatgccaatctgcttcttattttgataacttcttcatctttct 321  Q
    ||||||||||| | ||||||||  || |||||| |||||||||| | ||||||||||||||| | || ||||||||| |  |||||||| ||||||||||    
35607671 ttgtgctactgctattataattg-tcttcttctgtgtttattttaccaatctgttagaatgctattcagcttcttatatctataacttcctcatctttct 35607769  T
322 gttattata 330  Q
    |||||||||    
35607770 gttattata 35607778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 303 - 337
Target Start/End: Original strand, 5663274 - 5663308
Alignment:
303 ataacttcttcatctttctgttattatactactgt 337  Q
    |||||||||||||||||||||||||||||||||||    
5663274 ataacttcttcatctttctgttattatactactgt 5663308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University