View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_73 (Length: 286)
Name: NF11703_low_73
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 206 - 280
Target Start/End: Complemental strand, 4095652 - 4095581
Alignment:
| Q |
206 |
acatattcatttttccttgcttttattgaactggtaccgatcatcaagtcaccatcccagctacaaggacaagga |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4095652 |
acatattcatttttccttgcttttattgaactggtaccg---atcaagtcaccatcccagctacaaggacaagga |
4095581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 205
Target Start/End: Complemental strand, 4095774 - 4095708
Alignment:
| Q |
138 |
ataaatgttcctctaaagtacaagtttacggtcctactcgtcattatgtctaagatggtgacctaatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095774 |
ataaatgttcctctaaagtacaagtttacg-tcctactcgtcattatgtctaagatggtgacctaatt |
4095708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University