View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_low_93 (Length: 242)
Name: NF11703_low_93
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_low_93 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 55163554 - 55163776
Alignment:
| Q |
18 |
tgaagaaactaaacatgtccctgtgacactgtgacttaatttttatttatgaacctccttaacttttcactagaacctttctttgtaaaccctaccagtc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55163554 |
tgaagaaactaaacatgtccctgtgacactgtgacttaatttttatttatgaacctccttaactt--cactagaacctttctttgtaaaccctaccagtc |
55163651 |
T |
|
| Q |
118 |
cgagttctcagggagaattgtaaccactctgattggatttacatgagcagttaaataaaggtaaatcattcaaatgaacaaagagtttaannnnnnngta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
55163652 |
cgagttctcagggagaattgtaaccactctgattggatttacatgagcagttaaataaaggtaaatcattcaaatgaacaaagagtttaatttttttgta |
55163751 |
T |
|
| Q |
218 |
tgttgtttgtacaatcacaattaat |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
55163752 |
tgttgtttgtacaatcacaattaat |
55163776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University