View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11704_high_15 (Length: 287)
Name: NF11704_high_15
Description: NF11704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11704_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 50 - 273
Target Start/End: Complemental strand, 41812524 - 41812301
Alignment:
| Q |
50 |
ctttgagtctttgagatgattcccttgagatagacattacactcgcggcgataatcaatcaacaaacagagctgcctgatggcctccctcttttcctctc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41812524 |
ctttgagtctttgagatgattcccttgagatagacattacactcgcggtgataatcaatcaacaaacagagctgcctgatggcctccctcttttcctctc |
41812425 |
T |
 |
| Q |
150 |
ccaaatccaacatgccttcctctttctcttttatcaacttctgtagctcttcaactgtcttcttaagttcatcaacagttgctgtcacattcatcttctc |
249 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41812424 |
ccaaatccaatattccttcctctttctcttttatcaacttctgtagctcttcaactgtcttcttaagttcatcaacagttgctgtcacattcatcttctc |
41812325 |
T |
 |
| Q |
250 |
tgattcctcctttcttgcctttgc |
273 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41812324 |
tgattcctcctttcttgcctttgc |
41812301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 56 - 270
Target Start/End: Complemental strand, 41799302 - 41799088
Alignment:
| Q |
56 |
gtctttgagatgattcccttgagatagacattacactcgcggcgataatcaatcaacaaacagagctgcctgatggcctccctcttttcctctcccaaat |
155 |
Q |
| |
|
|||||||| |||||| |||||||| | || ||| ||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41799302 |
gtctttgatatgatttccttgagacggtcactactctcacggtgataatcaatccacaaacagagctgcctgatggcctccctcttttcctctcccaaat |
41799203 |
T |
 |
| Q |
156 |
ccaacatgccttcctctttctcttttatcaacttctgtagctcttcaactgtcttcttaagttcatcaacagttgctgtcacattcatcttctctgattc |
255 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41799202 |
ccaatatgccttcctctttctctttcatcgacttctctagctctccaactgtcttcttaagttcaacaacagttgctgtcacattcatcttctctgattc |
41799103 |
T |
 |
| Q |
256 |
ctcctttcttgcctt |
270 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41799102 |
ctcctttcttgcctt |
41799088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 54 - 273
Target Start/End: Complemental strand, 41805690 - 41805470
Alignment:
| Q |
54 |
gagtctttgagatgattcccttgagatagacattacactcgcggcgataatcaatcaacaaacagagctgcctgatggcctccctcttttcctctcccaa |
153 |
Q |
| |
|
|||||||||| |||| | |||| |||||| |||| | ||| | | ||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41805690 |
gagtctttgatatgaattcctttagatagtcattgcgctccctgtgataatcaatccgcaaacaaagctgcctgatggcctccctcttttcctctcccaa |
41805591 |
T |
 |
| Q |
154 |
atccaacatgccttcctctttctcttttatcaacttctgtagctcttcaactgtcttcttaagttcatcaacagttgctgtcacattcatcttctctga- |
252 |
Q |
| |
|
| |||||| || ||||||||||||| |||||||||| ||||||||||||| |||||||||||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
41805590 |
gttcaacataccctcctctttctcttccatcaacttctctagctcttcaactctcttcttaagttcaacaacaattgttgtcacattcatcttctctgat |
41805491 |
T |
 |
| Q |
253 |
ttcctcctttcttgcctttgc |
273 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
41805490 |
ttccccctttcttgcctttgc |
41805470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University