View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11704_low_20 (Length: 253)
Name: NF11704_low_20
Description: NF11704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11704_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 27328301 - 27328068
Alignment:
| Q |
1 |
tatggtgtttctccatgttgtggtacgttcaagagttactgactttgggtgacctggatcattgatcaattggacattggcccggtctgaaacaattgct |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328301 |
tatggtgtttgtccatgttgtggtacgttcaagagttactgactttgggtgacctggatcattgatcaattggacattggcccggtctgaaacaattgct |
27328202 |
T |
 |
| Q |
101 |
ccccta-cctttaattgacgaagtaagatgatgacatgtgttcagtccatgcttttagagccgtttcatgctacttcttttgcggcctcaagagatttat |
199 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27328201 |
cccctaacctttaatcgacgaagtaagatgatgacatgtgttcagtccattctttcagagccgtttcatgctacttcttttgcggcctcaagagatttat |
27328102 |
T |
 |
| Q |
200 |
ttatttattttacaatgaagtggattctttgcgg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27328101 |
ttatttattttacaatgaagtggattctttgcgg |
27328068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University