View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11704_low_21 (Length: 202)
Name: NF11704_low_21
Description: NF11704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11704_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 9 - 184
Target Start/End: Complemental strand, 9223199 - 9223024
Alignment:
| Q |
9 |
aagcagagagggttatcttttattgcttttgattctaagaagaactcagaaccagtgggagaagataatgatcaagccctagatgcagttatgaaacttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223199 |
aagcagagagggttatcttttattgcttttgattctaagaagaactcagaaccagtgggagaagataatgatcaagccctagatgcagttatgaaacttt |
9223100 |
T |
 |
| Q |
109 |
attctgccttcaaaaataaaaacatacaagaattgtctgagatacttgcagatgaatgtagatgtgtgtgcaattt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223099 |
attctgccttcaaaaataaaaacatacaagaattgtctgagatacttgcagatgaatgtagatgtgtgtgcaattt |
9223024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University