View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11705_high_12 (Length: 279)
Name: NF11705_high_12
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11705_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 49040151 - 49040396
Alignment:
| Q |
16 |
catatggagccatctcgttccacattacaccgctttggtaacacttcaagtagttcactttggtatgagttagcatacgtagaggccaagggtagagttt |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040151 |
catatggagccatcttgttccacattacatcgctttggtaacacttcaagtagttcactttggtatgagttagcatacgtagaggccaagggtagagttt |
49040250 |
T |
|
| Q |
116 |
caaagggggatagggtgtggcagattgattgcatttggggctggttttaaatgtaacagtgccgtatggagggcatgtcgtgacataccacttctacatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040251 |
caaagggggatagggtgtggcagatt----gcatttggggcaggttttaaatgtaacagtgccgtatggagggcatgtcgtgacataccacttctacatg |
49040346 |
T |
|
| Q |
216 |
actggacgggaaatccatgggatgactctgttaacaactaccctattcat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040347 |
actggacgggaaatccatgggatgactctgttaacaactaccctattcat |
49040396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 92
Target Start/End: Complemental strand, 19671813 - 19671772
Alignment:
| Q |
51 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
92 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19671813 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19671772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 92
Target Start/End: Complemental strand, 19742933 - 19742892
Alignment:
| Q |
51 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
92 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19742933 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19742892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 92
Target Start/End: Original strand, 19797155 - 19797196
Alignment:
| Q |
51 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
92 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19797155 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19797196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University