View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11705_high_14 (Length: 254)
Name: NF11705_high_14
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11705_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 12 - 183
Target Start/End: Original strand, 47856077 - 47856249
Alignment:
| Q |
12 |
gagatgagatcattaagaggacatagtgatttaaaagataannnnnnnnncttaccctctaatcttctcgcgtgtcctatctttgggttcaaatattcnn |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47856077 |
gagatgagatcattaagaggccatagtgatttaaaagataatttttttt-cttaccctctaatcttctcgcgtgtcctatctttgggttcaaatattcaa |
47856175 |
T |
 |
| Q |
112 |
nnnnn--tgtaggnnnnnnnnaatgtgttctaagctttgaaaatatagtttgaaatctaatgatgcatgtgtac |
183 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47856176 |
aaaaaaatgtagggtttttttaatgtgttctaagctttgaaaatatagtttgaaatctaatgatgcatgtgtac |
47856249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 180 - 254
Target Start/End: Original strand, 47857710 - 47857785
Alignment:
| Q |
180 |
gtacgtgaccccatcaataaaaggagtgtttcttgtcctattttaggt-atcttaaatctctctattactgttttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
47857710 |
gtacgtgaccccatcaataaaaggagtgtttcttgtcctattttaggtaatcttatatctctctattactgttttt |
47857785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University