View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11705_high_15 (Length: 242)
Name: NF11705_high_15
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11705_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 47857893 - 47858020
Alignment:
| Q |
1 |
ttatataattagtatcaatcacttatgttgaaatctttatttatattggaggctatattgagatctttaattatgacatgtttgtattcatctacagctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47857893 |
ttatataattagtatcaatcacttatgttgaaatctttatttatattggaggctatattgagatctttaattatgacatgtttgtattcatctacagctg |
47857992 |
T |
 |
| Q |
101 |
tggataacattgatggctttgaacctct |
128 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
47857993 |
tggataacattgatggttttgaacctct |
47858020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 158 - 225
Target Start/End: Original strand, 47858055 - 47858122
Alignment:
| Q |
158 |
gtttgacattagtcatcatacctggccataatttaggacccctgctgatgggctaagttctatgttgc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47858055 |
gtttgacattagtcatcatacctggccataatttaggacccctgctgatgggctaagttctatgttgc |
47858122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University