View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11705_low_12 (Length: 293)
Name: NF11705_low_12
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11705_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 21220090 - 21219806
Alignment:
| Q |
1 |
taaatctatagaatatgtcttgtttgatacgatgataggagagttctcataaacatagttttccacaatccctccatctatggccgtagtcaccatcatg |
100 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21220090 |
taaatctatataatatgtcttgcttgatacagtgattggagagttctcataaacatagttttctacaatccctccatctgtggccgtagtcaccatcatg |
21219991 |
T |
 |
| Q |
101 |
agggaatttagtggtgaaacagataactgaagagtttcaacacactagaaggaaataaaagaacaagttgcaccacaatcaaacataactgaaacaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21219990 |
agggaatttagtggtgaaacagataactgaagagtttcaacacactggaaggaaataaaagaacaagttgcaccacaatcaaacataactgaaacacgat |
21219891 |
T |
 |
| Q |
201 |
tctggccaagaaaacacatatcgtcgattaagtcctcattagcctgagctttctttccatcagacgaataaaccctacctatgct |
285 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21219890 |
tctggccaagaaaacacatatcgccgattaagtcctcattagcctgagctttctttccatcagacgaataaaccctacctttgct |
21219806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University