View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11705_low_20 (Length: 221)
Name: NF11705_low_20
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11705_low_20 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 21220341 - 21220132
Alignment:
| Q |
12 |
attggaatatcactagggcttacatctgattctgaagtcatagtgagcatggcatagaaacccttgtcttcagcacaaatgaactggatcatctgatatg |
111 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21220341 |
attgaaatatcactggggcttacatctgattctgaagtcatagtgagcatggcatagaaacccttgtcttcagcacaaatgaactggatcatctgatatg |
21220242 |
T |
|
| Q |
112 |
tgtacttaagtagttctgacaaggttactccttcgaccgtattactggtaggcatgtagatacttttctttgaacacccaatatacacatggtttgcgga |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21220241 |
tgtgcttaagtagttctgacaaggttactccttcgaccgtattactggtaggcatgtagatacttttctttgaacacccaatatacacatggtttgcgga |
21220142 |
T |
|
| Q |
212 |
aagccaatcc |
221 |
Q |
| |
|
|||| ||||| |
|
|
| T |
21220141 |
aagctaatcc |
21220132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University