View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11705_low_4 (Length: 583)

Name: NF11705_low_4
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11705_low_4
NF11705_low_4
[»] chr4 (1 HSPs)
chr4 (317-565)||(43169774-43170025)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 3e-96
Query Start/End: Original strand, 317 - 565
Target Start/End: Complemental strand, 43170025 - 43169774
Alignment:
317 attcactcacttgcttcatcttgttgtttttgtcgatttgtggctcgaacacactcttgatcccagttatagatcaatttcagaggttgttattttgcaa 416  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
43170025 attcactcacttgcttcatcttgttgtttttgtcgatttgtggctcgaacacactcttgatcccagttatagatcaatttcagaggttgttattttgaaa 43169926  T
417 aacctggtttttaatggtaattaagagcatgagttgttttgcatttttaaatgag---tgnnnnnnnnngttgctaatccacactaattaggatctctag 513  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||   |           || ||||||||| |||||||||||||||||    
43169925 aacctggtttttaatggtaattaatagcatgagttgttttgcatttttaaatgagttttttttttttctttttctaatccaccctaattaggatctctag 43169826  T
514 cgctccaaattatctcatgtcttatgttctttgaaaccactatgagactaat 565  Q
    ||||||||||||||||| ||||||||| ||||||||||||||||||||||||    
43169825 cgctccaaattatctcacgtcttatgtcctttgaaaccactatgagactaat 43169774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University