View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11705_low_4 (Length: 583)
Name: NF11705_low_4
Description: NF11705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11705_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 3e-96
Query Start/End: Original strand, 317 - 565
Target Start/End: Complemental strand, 43170025 - 43169774
Alignment:
| Q |
317 |
attcactcacttgcttcatcttgttgtttttgtcgatttgtggctcgaacacactcttgatcccagttatagatcaatttcagaggttgttattttgcaa |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43170025 |
attcactcacttgcttcatcttgttgtttttgtcgatttgtggctcgaacacactcttgatcccagttatagatcaatttcagaggttgttattttgaaa |
43169926 |
T |
|
| Q |
417 |
aacctggtttttaatggtaattaagagcatgagttgttttgcatttttaaatgag---tgnnnnnnnnngttgctaatccacactaattaggatctctag |
513 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| | || ||||||||| ||||||||||||||||| |
|
|
| T |
43169925 |
aacctggtttttaatggtaattaatagcatgagttgttttgcatttttaaatgagttttttttttttctttttctaatccaccctaattaggatctctag |
43169826 |
T |
|
| Q |
514 |
cgctccaaattatctcatgtcttatgttctttgaaaccactatgagactaat |
565 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43169825 |
cgctccaaattatctcacgtcttatgtcctttgaaaccactatgagactaat |
43169774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University