View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11706_high_11 (Length: 239)
Name: NF11706_high_11
Description: NF11706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11706_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 19351180 - 19350963
Alignment:
| Q |
1 |
aaactatttgctcacaaatggatctcaattgttccccaataggatcccacatatactgtatgtttcaccaagaaattgcaaattaattgaacaagaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19351180 |
aaactatttgctcacaaatggatctcaattgttccccaataagatcccacatataccgtatgtttcaccaagaaattgcaaattaattgaacaataatct |
19351081 |
T |
|
| Q |
101 |
aatgcaccaatgagtttacggattataaaaggcatcccacacaagggtgatctgcaaattgggttcgaccaaccaattggaataaggattttaagctaat |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19351080 |
aatgcaccaatgagtttacggattaaaaaaggcatcccacacaagggtgatctgcaaattgggttcgaccaaccaattggaataaggattttaagctaat |
19350981 |
T |
|
| Q |
201 |
agttcaaacgaaatcggg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19350980 |
agttcaaacgaaatcggg |
19350963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University