View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11706_low_4 (Length: 317)
Name: NF11706_low_4
Description: NF11706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11706_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 303
Target Start/End: Complemental strand, 35756846 - 35756557
Alignment:
| Q |
14 |
acatcagggttaagttgacttttacttttcacgaaatacaaattacttttatttttctctcgtgtcaaattttgttctcaaggactaaaacgtttgtttg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35756846 |
acataagggttaagttgacttttacttttcacgaaataaaaattacttttatttttctctagtgtcaaattttgttctcaaggactaaaacgtttgtttg |
35756747 |
T |
|
| Q |
114 |
tgtgaacttttcaacaaacaaatataaacatggcgccgtacatttgcagcgactcactctcaacagtaaggttacatgaaaaatcacgctaatcactatc |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35756746 |
tgtgaacttttcaacaaacaaacataaacatggcgccgtacatttgcagcgactcactctcaacagtaaggttacatgaaaaatcacgctaatcactatc |
35756647 |
T |
|
| Q |
214 |
ctttcatttacttattaataatattatggattgtgtgattactatgatttattgtataggcatatcatatcatgtaaatacggataatat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35756646 |
ctttcatttacttattaataatattatggattgtgtgattactatgatttattgtataggcatatcatatcatgtaaatacggacaatat |
35756557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 290
Target Start/End: Original strand, 49931912 - 49931942
Alignment:
| Q |
260 |
atttattgtataggcatatcatatcatgtaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49931912 |
atttattgtataggcatatcatatcatgtaa |
49931942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 299
Target Start/End: Original strand, 45685367 - 45685404
Alignment:
| Q |
262 |
ttattgtataggcatatcatatcatgtaaatacggata |
299 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
45685367 |
ttattgtataggcatatcatatcaagtaaatagggata |
45685404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 293
Target Start/End: Original strand, 43819037 - 43819070
Alignment:
| Q |
260 |
atttattgtataggcatatcatatcatgtaaata |
293 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
43819037 |
atttaatgtataggcatatcatatcatgtaaata |
43819070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University