View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11706_low_6 (Length: 300)
Name: NF11706_low_6
Description: NF11706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11706_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 35 - 245
Target Start/End: Complemental strand, 37195128 - 37194918
Alignment:
| Q |
35 |
gttcgatcaaaaattgttttactaaagatttatactcaatttatatcaaatgatttgattttaactgatattcaatcaattgatacatcaaattgtaatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37195128 |
gttcgatcaaaaattgttttactaaagatttatactcaatttatatcaaatgatttgattttaactgatattcaatcacttgatacatcaaattgtaatt |
37195029 |
T |
 |
| Q |
135 |
tgagagatgagaattatagtcacaagatcgaaattgtatcgacacaatttgaatgcttctcacaaatgacatcttctatattaacgagtgcaaaaattac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195028 |
tgagagatgagaattatagtcacaagatcgaaattgtatcgacacaatttgaatgcttctcacaaatgacatcttctatattaacgagtgcaaaaattac |
37194929 |
T |
 |
| Q |
235 |
aatttatagtc |
245 |
Q |
| |
|
||||||||||| |
|
|
| T |
37194928 |
aatttatagtc |
37194918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 250 - 283
Target Start/End: Complemental strand, 37194897 - 37194864
Alignment:
| Q |
250 |
actatctggaatttatttaacgagtttaaaaatt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37194897 |
actatctggaatttatttaacgagtttaaaaatt |
37194864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University