View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11706_low_9 (Length: 269)
Name: NF11706_low_9
Description: NF11706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11706_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 111 - 220
Target Start/End: Complemental strand, 7035100 - 7034991
Alignment:
| Q |
111 |
gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7035100 |
gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt |
7035001 |
T |
 |
| Q |
211 |
tatgttgcta |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
7035000 |
tatgttgcta |
7034991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 53
Target Start/End: Complemental strand, 7035193 - 7035151
Alignment:
| Q |
11 |
tgagatgaacaaataaacttatgctactactggatatctgcat |
53 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7035193 |
tgagataaacaaataaacttatgctactacaggatatctgcat |
7035151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University