View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11707_high_4 (Length: 362)
Name: NF11707_high_4
Description: NF11707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11707_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 40937712 - 40937373
Alignment:
| Q |
1 |
ggtgcatgtaaaagaaaataaacaacaactcaaatactttttcatcaactaccaccaacatgtggtggtcttttttgatcaattctaacatgtggttaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40937712 |
ggtgcatgtaaaagaaaataaacaacaactcaaatactttttcatcaactaccaccaacatgtggtggtcttttttgatcaattc-aacatgtggttaga |
40937614 |
T |
 |
| Q |
101 |
cataatggtggggcggggatatgttttactttctctatgattacatacgtttacatattctcatctcttatcctatttatatttaatggggatataaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937613 |
cataatggtggggcggggatatgttttactttctctatgattacatacgtttacatattctcatctcttatcctatttatatttaatggggatataaaat |
40937514 |
T |
 |
| Q |
201 |
taaatttcatctcgaccgatttggatattctcgacccatcccatctctgcagtgcataannnnnnnaatnnnnnnntaagcgtttattagtcctgacgca |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
40937513 |
taaatttcatctcgatcgatttggatattctcgacccatcccatctctgcagtgcataatttttttaataaaaaaataagcgtttattagtcctgacgca |
40937414 |
T |
 |
| Q |
301 |
atattgtaatacaatatccagcaaaaagatgaggatagagg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40937413 |
atattgtaatacaatatccagcaaaaagatgaggatagagg |
40937373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University