View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11707_high_5 (Length: 345)
Name: NF11707_high_5
Description: NF11707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11707_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 23 - 338
Target Start/End: Original strand, 50453048 - 50453364
Alignment:
| Q |
23 |
acgagggcttatttaatggtaggtagataacatatgctgctgcaaataggaattgttgatgataaaatctcgaattaaattaaatagcataacatagacc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453048 |
acgagggcttatttaatggtaggtagataacatatgctgctgcaaataggaattgttgatgataaaatctcgaattaaattaaatagcataacatagacc |
50453147 |
T |
 |
| Q |
123 |
caggnnnnnnnn-tagcataaaatggacggtacaaaccaggatatgactcggtgcttatccacaactcgtgtgtctagaaaatgatactacacgacaatg |
221 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50453148 |
cagaaaaaaaaaatagcataaaatgaacggtacaaaccaggatatgactcggtgcttatccacaactcttgtgtctagaaaatgatactacacgacaatg |
50453247 |
T |
 |
| Q |
222 |
accattttcaatttttcaccaatttcaatggaatggtttagtttctccttcgggatgccctggtaaacatatctttgatgttatgtgattctgtctccac |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453248 |
accattttcaatttttcaccaatttcaatggaatggtttagtttctccttcgggatgccctggtaaacatatctttgatgttatgtgattctgtctccac |
50453347 |
T |
 |
| Q |
322 |
tttcatcttctctgctt |
338 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
50453348 |
tttcatcttctttgctt |
50453364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University