View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11707_high_6 (Length: 329)
Name: NF11707_high_6
Description: NF11707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11707_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 13 - 311
Target Start/End: Original strand, 27814747 - 27815054
Alignment:
| Q |
13 |
agaagaacatgcatcttcctggaannnnnnnncattcaaatggtggctaacaaactctgtccaagccaaattgctttgtgtgtcacaccagctttattgt |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27814747 |
agaagaacatgcatcttcctggaatttttttccattcaaatgttggctaacaaactctgtagaagccaaattgctttgtgtgtcacaccagctttattgt |
27814846 |
T |
 |
| Q |
113 |
tggaaagctacgaagttgacctttcgaagccaaattccatctctcgccactttattgaaatgttgtgnnnnnnnattgattttgttttactgaaccatgt |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27814847 |
tggaaagctaagaagttgacctttcgaagccaaatt-catctctcgccactttactgaaatgttgtg-ctttttattgattttgttttactgaaccatgt |
27814944 |
T |
 |
| Q |
213 |
-----------tagctcaaatggtggctaaccatgtttcacaatcaannnnnnnnccgtcactagccaccatttaatttcattcatgaagaacaaagcct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27814945 |
tattccatctctagctcaaatggtggctaaccatgtttcacaatcaattttttttccatctctagccaccatttaatttcattcatgaagaacaaagcct |
27815044 |
T |
 |
| Q |
302 |
accagagaac |
311 |
Q |
| |
|
| ||||||| |
|
|
| T |
27815045 |
cctagagaac |
27815054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 273 - 308
Target Start/End: Complemental strand, 12685583 - 12685548
Alignment:
| Q |
273 |
tttaatttcattcatgaagaacaaagcctaccagag |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12685583 |
tttaatttcattcatgaagaacaaagccttccagag |
12685548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University