View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11707_high_9 (Length: 243)

Name: NF11707_high_9
Description: NF11707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11707_high_9
NF11707_high_9
[»] chr8 (1 HSPs)
chr8 (89-122)||(7045361-7045394)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 122
Target Start/End: Original strand, 7045361 - 7045394
Alignment:
89 ggtatttgggttgcatgtgttggaatatagagga 122  Q
    ||||||||||||||||||||||||||||||||||    
7045361 ggtatttgggttgcatgtgttggaatatagagga 7045394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University