View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11707_low_11 (Length: 243)
Name: NF11707_low_11
Description: NF11707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11707_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 122
Target Start/End: Original strand, 7045361 - 7045394
Alignment:
| Q |
89 |
ggtatttgggttgcatgtgttggaatatagagga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7045361 |
ggtatttgggttgcatgtgttggaatatagagga |
7045394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University