View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11707_low_13 (Length: 208)
Name: NF11707_low_13
Description: NF11707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11707_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 34670773 - 34670602
Alignment:
| Q |
17 |
agaatcgatgctacactg--aaaccaggaaaacatttgtcagcatgttatatcaaagaaaattgtagctcatatcatgaatgatagtttgtcacatatca |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
34670773 |
agaatcgatgctacactgtgaaaccaggaaaacatttgtcagcatgttatatcaaagaaaattgtagctcatatcatgaatgatattttgtcatatatca |
34670674 |
T |
|
| Q |
115 |
caaaggttgaatgaagaannnnnnnggaagttggaaacttagaatcacatgtagatgaaatattataagtcag |
187 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34670673 |
caaaggtttaatgaagaatttttttggaa-ttggaaacttagaatcacatgtagatgaaatattataagtcag |
34670602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University