View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11708_high_23 (Length: 298)
Name: NF11708_high_23
Description: NF11708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11708_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 14791445 - 14791164
Alignment:
| Q |
1 |
aaaggagaataattccaccac-------agtgagaatatgatttgtgatcaaagcgtgggttctgtttcatccagcgatgccaatggctggcataatgtg |
93 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791445 |
aaaggagaataattccaccacgtccagtagtgagaatatgatttgtgatcaaagcgtgggttctgtttcatccagcgatgccaatggctggcataatgtg |
14791346 |
T |
 |
| Q |
94 |
atcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattatcccttttattttactattggatgtaagtatgcttat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791345 |
atcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattatcccttttattttactattggatgtaagtatgcttat |
14791246 |
T |
 |
| Q |
194 |
gttaattagcattctgattatgaactcttccatcaattgtctttacaacatatattgtcttcataggtagaagggccgttcg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||| ||||| |
|
|
| T |
14791245 |
gttaattagcattctgattatgaactcttccatcaattgtctttacaacacatattgtgttgataggtagaagggctgttcg |
14791164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University