View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11708_low_25 (Length: 262)
Name: NF11708_low_25
Description: NF11708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11708_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 96 - 249
Target Start/End: Complemental strand, 7698633 - 7698480
Alignment:
| Q |
96 |
tcatgcattgaatttgaaatattcaacatcattaattgtgaaagcaattatttgtactttcacctttgacaatcactgtggaattgagctggacaaggat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
7698633 |
tcatgcattgaatttgaaatattcaacatcattaattgtgaaagcaattatttgtactttcacctttggcaatcactgtggaattgagctggaaaaggat |
7698534 |
T |
|
| Q |
196 |
cacatgtcttcaacaaagtcttacaattgggccatgcccactataatgtgtcct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7698533 |
cacatgtcttcaacaaagtcttacaattgggccatgcccactataatgtgtcct |
7698480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 7698695 - 7698643
Alignment:
| Q |
1 |
atttaaagcaacagtagttgcatggtcatgcaagagccacgaaactgtagttg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7698695 |
atttaaagcaacagtagttgcatggtcatgcaagagccacgaaactgtagttg |
7698643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University