View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11709_high_10 (Length: 252)
Name: NF11709_high_10
Description: NF11709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11709_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 50 - 235
Target Start/End: Complemental strand, 45743729 - 45743544
Alignment:
| Q |
50 |
ggttttgtgtgattgagttaggatcggttttgtgtgattgagttagcgccagactattgtttgcatgttgatttcatatgaatatgaatacaactaaaac |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45743729 |
ggttttgtgtgattgagttaggatcggttttgtgtgattgagttagcgtcagactattgtttgcatgttgatttcatatgaatatgaatacaactaaaac |
45743630 |
T |
|
| Q |
150 |
caggaatctttgtttttgcaggctgttaatgcgaatgatagcagcatgttgattctgcaagaaacttggatggatacatcttgctc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45743629 |
caggaatctttgtttttgcaggctgttaatgcgaatgatagcagcatgttgattctgcaagaaacttggatggatacatcttgctc |
45743544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 45743786 - 45743709
Alignment:
| Q |
18 |
ttataaagcttaaacaatcctccttttaagtcggttttgtgtgattgagttaggatcggttttgtgtgattgagttag |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45743786 |
ttataaagcttaaacaatcctccttttaagttggttttgtgtgattgagttaggattggttttgtgtgattgagttag |
45743709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University