View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11709_low_16 (Length: 209)
Name: NF11709_low_16
Description: NF11709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11709_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 50270753 - 50270678
Alignment:
| Q |
16 |
ataggaactcacatatgacatagcccatatccaaaattataataaattcaagtatgtgaactcaattgagttcatg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50270753 |
ataggaactcacatatgacatagcccatatccaaaattataataaattcaagtatgtgaactcaattgagttcatg |
50270678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 186
Target Start/End: Complemental strand, 50270620 - 50270574
Alignment:
| Q |
140 |
gagtttgcgtatatgtgtgtgagttctcgcgtgattcttaaatgttg |
186 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50270620 |
gagtttgcgtatatgtgtgtgagatctcccgtgattcttaaatgttg |
50270574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University