View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11709_low_2 (Length: 710)
Name: NF11709_low_2
Description: NF11709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11709_low_2 |
 |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold0691 (1 HSPs) |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 7e-57; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 7e-57
Query Start/End: Original strand, 8 - 148
Target Start/End: Original strand, 43658909 - 43659049
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43658909 |
gagaagaaccggttgtactctgggggagttgcgcaattctgcggataattccttagtttagtgacattgtcatgcctcagattttacgtttcattttctt |
43659008 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
43659009 |
gttttgcaggttgtgatccttcagttatccgcaaacaacaa |
43659049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 38640775 - 38640642
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||| ||||| || |
|
|
| T |
38640775 |
gagatgaacctgttgtactctgggggagttgcacaattctgcggataattccttagttcagtgacatagtcacgcctcaggttttacgttttattttatt |
38640676 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38640675 |
attttgcaggttgtgatccttcagtcatccgcga |
38640642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 83; E-Value: 6e-39
Query Start/End: Original strand, 50 - 148
Target Start/End: Original strand, 43654317 - 43654415
Alignment:
| Q |
50 |
ggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttcttgttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43654317 |
ggataattccttagttcagtgacattgtcacgcctcatgttttatgtttcattttcttgttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
43654415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 19723311 - 19723370
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19723311 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
19723370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 4840140 - 4840199
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4840140 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtcattacc |
4840199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 653 - 710
Target Start/End: Complemental strand, 27881118 - 27881061
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
27881118 |
gagagaacccgggttcgagccccgctagtgcctttgaagggaggtaaatgtaaatacc |
27881061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 653 - 710
Target Start/End: Complemental strand, 28021299 - 28021242
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
28021299 |
gagagaacccgggttcgagccccgctagtgcctttgaagggaggtaaatgtaaatacc |
28021242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 653 - 710
Target Start/End: Complemental strand, 32296769 - 32296712
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32296769 |
gagagaacccgggttcaagccctgctagtgcctttgaagggaggtaaatgtaattacc |
32296712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 11404002 - 11404060
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||||||||||||||||| |||| |
|
|
| T |
11404002 |
cgagagaacctgggttcgagcctcgctagtgtctttggagggaggtaaatgtaaatacc |
11404060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 669 - 710
Target Start/End: Original strand, 17095568 - 17095609
Alignment:
| Q |
669 |
gagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17095568 |
gagccccgctagtgcctttggagggaggtaaatgtaattacc |
17095609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 653 - 701
Target Start/End: Original strand, 29767190 - 29767238
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaat |
701 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
29767190 |
gagagaacccggggtcgagccccgctagtgcctttgaagggaggtaaat |
29767238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 666 - 710
Target Start/End: Complemental strand, 24475113 - 24475069
Alignment:
| Q |
666 |
ttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24475113 |
ttcgagctccgctagtgcctttggagggaggtaaatgtaaatacc |
24475069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 654 - 710
Target Start/End: Complemental strand, 28739690 - 28739634
Alignment:
| Q |
654 |
agagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||||||||| | |||||||||| |||| |
|
|
| T |
28739690 |
agagaacctgggttcaagccccactagtgcctttggaggaaagtaaatgtaaatacc |
28739634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 22711509 - 22711568
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||| |||||| ||| || ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
22711509 |
ccgagagaactcgggtttgagtccaactaatgcctttggagggaggtaaatgtaaatacc |
22711568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 680 - 710
Target Start/End: Complemental strand, 21355087 - 21355057
Alignment:
| Q |
680 |
gtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21355087 |
gtgcctttggagggaggtaaatgtaattacc |
21355057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 104; Significance: 2e-51; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 41455503 - 41455372
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
41455503 |
gagatgaacctgttgtactttgggggagttgcgcaattctgcggataattccttagttcagtgacatagtcacgcctcagattttactttttattttctt |
41455404 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |
|
|
| T |
41455403 |
gttttgtaggttatgatccttcagtcatccgc |
41455372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 41451820 - 41451688
Alignment:
| Q |
8 |
gagatgaacctgttgtactctggggg-agttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttct |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||| |||||||| ||||||||||| |||||| ||| ||||||| |
|
|
| T |
41451820 |
gagatgaacctgttgtactctggggggagttgcacaattctgcggataattccttagtttagtgacatagtcacgcctcatgttttactttttattttct |
41451721 |
T |
 |
| Q |
107 |
tgttttgcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
41451720 |
tgttttgcaggttatgatccttcagtcatccgc |
41451688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 88; E-Value: 6e-42
Query Start/End: Original strand, 8 - 139
Target Start/End: Original strand, 32355239 - 32355370
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||| |||||| ||| ||||||||| ||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
32355239 |
gagatgaacctgttgtactctggagaagttgcgtaattctgcgaataatttcttagttcagtgatattgtcacgcctcaggttttactttttattttctt |
32355338 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
32355339 |
gttttgcaggttatgatccttcagtcatccgc |
32355370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 16059485 - 16059426
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16059485 |
ccgagagaacccgggttcgagccccgctagtgcctttgcagggaggtaaatgtaattacc |
16059426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 35109691 - 35109750
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35109691 |
ccgagagaacccgggttcgagccccactagtgcctttggagggaggtaaatgtaattacc |
35109750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 38265369 - 38265310
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265369 |
ccgagagaacctgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
38265310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 41151172 - 41151231
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41151172 |
ccgagagaacccgggttcgagccccgctagtgtctttggagggaggtaaatgtaattacc |
41151231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 12472121 - 12472180
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
12472121 |
ccgagagaacccgggttcgagccccactagtgcctttggagggaggtaaatataattacc |
12472180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 18117076 - 18117017
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18117076 |
ccgagagaacccgggttcgagccacgctagtgcctttagagggaggtaaatgtaattacc |
18117017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 34721834 - 34721893
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34721834 |
ccgagagaacccggattcaagccccgctagtgcctttggagggaggtaaatgtaattacc |
34721893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 21577230 - 21577171
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
21577230 |
ccgagagaacccgggttcgagccccactaatgcctttggagggaggtaaatgtaaatacc |
21577171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 651 - 705
Target Start/End: Original strand, 48176399 - 48176453
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48176399 |
ccgagagaatccgggttcgagccccgctagtgcctttggaaggaggtaaatgtaa |
48176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 653 - 710
Target Start/End: Original strand, 11216771 - 11216828
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
11216771 |
gagagaacccgggttcgagccccattagtgcctttggagggaggtaaatgtaaatacc |
11216828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 651 - 708
Target Start/End: Original strand, 45278452 - 45278509
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatta |
708 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
45278452 |
ccgagataacccgggttcgagccccgctagtgcctttgaagggaagtaaatgtaatta |
45278509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 651 - 708
Target Start/End: Complemental strand, 38405286 - 38405229
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatta |
708 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38405286 |
ccgagagaattcgagttcgagcctcgctagtgcctttggagggaggtaaatgtaatta |
38405229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 664 - 708
Target Start/End: Complemental strand, 245383 - 245339
Alignment:
| Q |
664 |
ggttcgagccccgctagtgcctttggagggaggtaaatgtaatta |
708 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
245383 |
ggttcgagccccgctagtgcccttggagggaggtaaatgtaatta |
245339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 669 - 710
Target Start/End: Complemental strand, 37095324 - 37095283
Alignment:
| Q |
669 |
gagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37095324 |
gagccccgctagtgtctttggagggaggtaaatgtaattacc |
37095283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 23028684 - 23028742
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| |||||||||| | || ||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
23028684 |
cgagagaatccgggttcgaactcctctaatgcctttagagggatgtaaatgtaattacc |
23028742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 97; Significance: 3e-47; HSPs: 25)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 7 - 131
Target Start/End: Original strand, 8363300 - 8363424
Alignment:
| Q |
7 |
tgagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttct |
106 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||| |||| |||||| ||||||||||| |
|
|
| T |
8363300 |
tgagatgaccctgttgtactctggaggagttgcgcaattctgcggataattccttagttcagtgacatagtcacgcatcaggttttacctttcattttct |
8363399 |
T |
 |
| Q |
107 |
tgttttgcaggttgtgatccttcag |
131 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8363400 |
tgttttgcaggttgtgatccttcag |
8363424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 45137102 - 45137043
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45137102 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
45137043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 6672925 - 6672866
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6672925 |
ccgagagaacccgggttcaagccccgctagtgcctttggagggaggtaaatgtaattacc |
6672866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 25987794 - 25987735
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25987794 |
ccgagagaactcgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
25987735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 40156040 - 40156099
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40156040 |
ccgagagaatccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
40156099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 63 - 140
Target Start/End: Original strand, 8365593 - 8365670
Alignment:
| Q |
63 |
gttcagtgacattgtcacgcctcagattttacgtttcattttcttgttttgcaggttgtgatccttcagtcatccgcg |
140 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| |||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8365593 |
gttcagtgacatagtcacgcctcaggttttatttttcatgttcttgtttttcaggttgtgatccttcagtcatccgcg |
8365670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 21637898 - 21637956
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21637898 |
cgagagaacccgggtttgagccccgctagtgcctttggagggaggtaaatgtaaatacc |
21637956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 653 - 710
Target Start/End: Original strand, 17136389 - 17136446
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
17136389 |
gagagaacccgggttcgagccccgttagtgcctttggagggaggtaaatgtaaatacc |
17136446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 652 - 708
Target Start/End: Complemental strand, 10745363 - 10745307
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatta |
708 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10745363 |
cgagagaacccgggtccgagccccgctagtgcctttagagggaggtaaatgtaatta |
10745307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 33357996 - 33358055
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttca |
67 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
33357996 |
gagatgaacctgttgtactctggaggagttgcgcaattctacggataattccttagttca |
33358055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 36836461 - 36836402
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36836461 |
ccgagagaacccgagttcgagtcccgctggtgcctttggagggaggtaaatgtaattacc |
36836402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 8 - 142
Target Start/End: Original strand, 27529086 - 27529220
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||||| ||||| | |||| |||||| |||||| ||||||||||||||| || |||||| | ||||||||||| ||| | || |||||| || |
|
|
| T |
27529086 |
gagatgaacctattgtattatgggtgagttgtgcaattatgcggataattccttagtctagtgacgtagtcacgcctcatttttcagtttacattttatt |
27529185 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaa |
142 |
Q |
| |
|
|||||| || |||||||| ||| |||||||||||| |
|
|
| T |
27529186 |
gttttgtagtttgtgatcattcggtcatccgcgaa |
27529220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 651 - 704
Target Start/End: Complemental strand, 7860278 - 7860225
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgta |
704 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7860278 |
ccgagagaacctgggtttgagccccgctagtgcctttggagggaggtaaatgta |
7860225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 654 - 710
Target Start/End: Original strand, 3200884 - 3200940
Alignment:
| Q |
654 |
agagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3200884 |
agagaacctggattcgagcctcgctagtgcctttggagggaggtaaatgtaattacc |
3200940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 44650393 - 44650452
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44650393 |
ccgagagaacccgatttcgagctccgttagtgcctttggagggaggtaaatgtaattacc |
44650452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 26690155 - 26690213
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26690155 |
cgagagaatctgggttcgagtcccgctagtgcttttggagggaggtaaatgtaattacc |
26690213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 2357207 - 2357148
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
2357207 |
ccgagagaacccgggttcgagttccactagtacctttggagggaggtaaatgtaaatacc |
2357148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 2754183 - 2754124
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||| |||||| ||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2754183 |
ccgagagaacccggattcgagtcccactaatgcctttggagggaggtaaatgtaaatacc |
2754124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 5039420 - 5039479
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
5039420 |
ccgagagaactcgggttcgagctccgctagtgcttttagagggaggtaaacgtaattacc |
5039479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 652 - 707
Target Start/End: Complemental strand, 36380263 - 36380208
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatt |
707 |
Q |
| |
|
||||| ||| |||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36380263 |
cgagaaaactcgggtttgaaccccgctagtgcctttggagggaggtaaatgtaatt |
36380208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 652 - 705
Target Start/End: Complemental strand, 30372811 - 30372758
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
||||||| || |||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30372811 |
cgagagatcctgggttcgagctccgctagtgcctttggaaggaggtaaatgtaa |
30372758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 673 - 709
Target Start/End: Complemental strand, 558549 - 558513
Alignment:
| Q |
673 |
cccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
558549 |
cccgctagtgcctttggagggaggtaaatgtaattac |
558513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 40862886 - 40862766
Alignment:
| Q |
13 |
gaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttcttgtttt |
112 |
Q |
| |
|
|||||||||||| | ||| ||| ||| | ||| ||||||||||| ||| ||||||||| ||||| ||||| ||||||| || |||||| ||||||| |
|
|
| T |
40862886 |
gaacctgttgtattttggaggaattgtgtaatcatgcggataattacttagttcagtgattacgtcacacctcatattttactttacattttattgtttt |
40862787 |
T |
 |
| Q |
113 |
gcaggttgtgatccttcagtc |
133 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
40862786 |
ataggttgtgatctttcagtc |
40862766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 652 - 710
Target Start/End: Complemental strand, 13047282 - 13047226
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
13047282 |
cgagagaatccgggttcgagccccgcatgt--ctttggagggaggtaaatataattacc |
13047226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 666 - 705
Target Start/End: Original strand, 20961496 - 20961535
Alignment:
| Q |
666 |
ttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
20961496 |
ttcgagctccgctagtgcccttggagggaggtaaatgtaa |
20961535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 96; Significance: 1e-46; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 8 - 139
Target Start/End: Original strand, 7972 - 8103
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||| |||||| |||||| ||| |||||||| |
|
|
| T |
7972 |
gagatgaacctgttgtactctgggggagttgcgcaattttgcggataattccttagttcagtgacatagtcacacctcaggttttactttttattttctt |
8071 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| |
|
|
| T |
8072 |
gttttgcaggttatgatccttccgtcatccgc |
8103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 2e-45; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 7 - 148
Target Start/End: Original strand, 6799125 - 6799266
Alignment:
| Q |
7 |
tgagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttct |
106 |
Q |
| |
|
||||| |||||||| ||||| ||||||||| |||||||||||||||||||||||| |||||||||||| |||||||| ||| |||||| ||| ||||||| |
|
|
| T |
6799125 |
tgagaagaacctgtagtactttgggggagtcgcgcaattctgcggataattccttagttcagtgacatagtcacgccacaggttttactttttattttct |
6799224 |
T |
 |
| Q |
107 |
tgttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6799225 |
tattttgcaggttgtgatccttcagtcatccgcaaacaacaa |
6799266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 8986733 - 8986594
Alignment:
| Q |
10 |
gatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgaca--ttgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| ||||||||||||| || |||||||| | ||||||||||||||||||||||| |||| || |
|
|
| T |
8986733 |
gatgaaccttttgtatgctgggggagttgcgcaattctacggataattccttagtccagtgacacgtagtcacgcctcagattttacgttttatttcatt |
8986634 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaacaaca |
147 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| || |||||| |
|
|
| T |
8986633 |
gttttgcagggtgtgatccttcggtcatccacgtacaaca |
8986594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 10 - 148
Target Start/End: Complemental strand, 8996206 - 8996066
Alignment:
| Q |
10 |
gatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgaca--ttgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||||||||||||||||||||| || |||||||| | |||| ||| ||||||||||||| |||| || |
|
|
| T |
8996206 |
gatgaacctgttgtattttgggggagttgtgcaattctgcggataattccttagtccagtgacacgtaatcacaccttagattttacgttttatttcatt |
8996107 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
8996106 |
gttttgcaggatgtgatccttcagtcatccgcatacaacaa |
8996066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 42528436 - 42528323
Alignment:
| Q |
18 |
tgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttcttgttttgcagg |
117 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42528436 |
tgttgtattttgggggagttgcgcaattctgcagataattcctta--------acatagtcacgcctcaagttttacgtttcattttcttgttttgcagg |
42528345 |
T |
 |
| Q |
118 |
ttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42528344 |
ttgtgatccttcagtcatccgc |
42528323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 652 - 709
Target Start/End: Original strand, 36192542 - 36192599
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36192542 |
cgagagaacccgggttcgagccccactagtgcctttggagggaggtaaatgtaattac |
36192599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 8740448 - 8740507
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8740448 |
ccgagagatcccgggttcgagccccgctagtgcctttggagggaggtaaatgtaaatacc |
8740507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 46494530 - 46494471
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
46494530 |
ccgagagaacccgggttcgagccccactagtgcctttggagggaggtaaatgtaaatacc |
46494471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 32139164 - 32139223
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32139164 |
ccgagagaacctgggttcgaaccccgctagtgtctttggagggaggtaaatgtaattacc |
32139223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 39863910 - 39863851
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39863910 |
ccgagagaacccgggttcggaccccgctagtgcctttggagggaagtaaatgtaattacc |
39863851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 51066493 - 51066552
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51066493 |
ccgagagaactcgggttcgagctccgctagtgcctttggagggaggtaaatataattacc |
51066552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 651 - 708
Target Start/End: Original strand, 50905748 - 50905805
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatta |
708 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50905748 |
ccgagagaatctgggttcgagccccgctagtgcctttggagagaggtaaatgtaatta |
50905805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 51714097 - 51714038
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||| ||| |||| |
|
|
| T |
51714097 |
ccgagagaacccgggttcgagccccactagtgcctttgaagggaggtaaatataaatacc |
51714038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 30970516 - 30970457
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||| |||||||||||||||| |||| |
|
|
| T |
30970516 |
ccgagagaatccgggttcgagcctcactagtgcctttgaagggaggtaaatgtaaatacc |
30970457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 652 - 709
Target Start/End: Complemental strand, 2294841 - 2294784
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
2294841 |
cgagagaactcgggttcgagtttcgctagtgcctttggaggaaggtaaatgtaattac |
2294784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 64 - 123
Target Start/End: Original strand, 6806927 - 6806985
Alignment:
| Q |
64 |
ttcagtgacattgtcacgcctcagattttacgtttcattttcttgttttgcaggttgtga |
123 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
6806927 |
ttcagtgacatagtcacgcctcaggttttac-ttttattttcttgttttgtaggttgtga |
6806985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 47627127 - 47627066
Alignment:
| Q |
651 |
ccgagagaacccgggttcgag--ccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
47627127 |
ccgagagaacccggattcgagagccccactagtgcctttgaagggaggtaaatgtaaatacc |
47627066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 651 - 703
Target Start/End: Complemental strand, 7173717 - 7173665
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgt |
703 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||||| |||||||||||| |
|
|
| T |
7173717 |
ccgagagaacctaggttcaagacccgctagtgcctttggaaggaggtaaatgt |
7173665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 662 - 710
Target Start/End: Complemental strand, 50399763 - 50399715
Alignment:
| Q |
662 |
cgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
50399763 |
cgggttcgagccccgctagtgctcttggaggaaggtaaatgtaaatacc |
50399715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 92; Significance: 3e-44; HSPs: 17)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 8 - 147
Target Start/End: Complemental strand, 13016481 - 13016342
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
|||| |||||||||||||| ||||| |||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13016481 |
gagaagaacctgttgtactatggggaagttacgcaattctgcagataattccttagttcagtgacattgtcacgcctcagattttacgttttattttctg |
13016382 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaacaaca |
147 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
13016381 |
tttttgcaggttatgatcctttagtcatccgcgaataaca |
13016342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 6e-39
Query Start/End: Original strand, 8 - 148
Target Start/End: Original strand, 47323268 - 47323405
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
|||| |||| ||||||||||| ||||| |||||||||| ||||||||||||||| |||| ||||||| ||||||| || |||||| ||| |||||||| |
|
|
| T |
47323268 |
gagaagaacatgttgtactcttggggaattgcgcaattttgcggataattccttagttcggtgacatagtcacgc---aggttttactttttattttctt |
47323364 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47323365 |
gttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
47323405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 34 - 148
Target Start/End: Original strand, 47326868 - 47326982
Alignment:
| Q |
34 |
agttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttcttgttttgcaggttgtgatccttcagtc |
133 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| ||||||| ||||||||||| ||||||| || | |||||||||||||||||||||||||||| ||| |
|
|
| T |
47326868 |
agttgcgcaattctgcggatatttccttagttctgtgacatagtcacgcctcaaattttactctttactttcttgttttgcaggttgtgatccttctgtc |
47326967 |
T |
 |
| Q |
134 |
atccgcgaacaacaa |
148 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47326968 |
atccgcgaacaacaa |
47326982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 30054574 - 30054515
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30054574 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
30054515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 651 - 709
Target Start/End: Original strand, 20014458 - 20014516
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20014458 |
ccgagagaacccgggttcgagtcccgctagtacctttggagggaggtaaatgtaattac |
20014516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 652 - 710
Target Start/End: Complemental strand, 30370191 - 30370133
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
30370191 |
cgagagaatccgggttcgagccccactagtgtctttggagggaggtaaatgtaattacc |
30370133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 4573379 - 4573438
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| ||| || |||||||||||||||||||||| |||| |
|
|
| T |
4573379 |
ccgagagaacccgggttcgagccccactaatgtctttggagggaggtaaatgtaaatacc |
4573438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 45324006 - 45324065
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
45324006 |
ccgagagaacctgggttccagccccgctagtgcttttggagggaggtaaatgtaaatacc |
45324065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 12025182 - 12025240
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
12025182 |
cgagagaacctgggttcgagccccattagtgcctttggaggaaggtaaatgtaattacc |
12025240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 652 - 705
Target Start/End: Original strand, 21090116 - 21090169
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21090116 |
cgagagaattcgggttcgagccccgctagtgccgttggagggaggtaaatgtaa |
21090169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 651 - 707
Target Start/End: Complemental strand, 30850972 - 30850916
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatt |
707 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
30850972 |
ccgagagaactcgggttcgagccccgttagtgtctttggagggaggtaaatataatt |
30850916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 664 - 710
Target Start/End: Complemental strand, 33763373 - 33763327
Alignment:
| Q |
664 |
ggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
33763373 |
ggttcgagccccgctagtgcctttagagggaggcaaatgtaattacc |
33763327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 663 - 709
Target Start/End: Complemental strand, 44438670 - 44438624
Alignment:
| Q |
663 |
gggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44438670 |
gggttcgagctccgctaatgcctttggagggaggtaaatgtaattac |
44438624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 669 - 710
Target Start/End: Original strand, 22024121 - 22024162
Alignment:
| Q |
669 |
gagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22024121 |
gagccctgctagtgcctttggatggaggtaaatgtaattacc |
22024162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 138
Target Start/End: Original strand, 291364 - 291407
Alignment:
| Q |
95 |
gtttcattttcttgttttgcaggttgtgatccttcagtcatccg |
138 |
Q |
| |
|
|||| ||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
291364 |
gttttattttatcgttttgcaggttgtgatccttcagtcatccg |
291407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 680 - 710
Target Start/End: Complemental strand, 14498182 - 14498152
Alignment:
| Q |
680 |
gtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14498182 |
gtgcctttggagggaggtaaatgtaattacc |
14498152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 651 - 697
Target Start/End: Original strand, 15034455 - 15034501
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggt |
697 |
Q |
| |
|
|||| ||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15034455 |
ccgaaagaacccaggttcgagccctactagtgcctttggagggaggt |
15034501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 88; Significance: 6e-42; HSPs: 20)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 6e-42
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 28703804 - 28703673
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||| ||||||| ||| |||||||| |
|
|
| T |
28703804 |
gagatgaacttgttgtactttgggggagttgcgcaattctgcggataattccttagttcagtgacataatcatgcctcaaattttactttttattttctt |
28703705 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |
|
|
| T |
28703704 |
gttttgcaggttatgatccttcactcatccgc |
28703673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 28 - 136
Target Start/End: Complemental strand, 36612068 - 36611959
Alignment:
| Q |
28 |
tgggggagttgcgcaattctgcggataattcctttgttcagtgacatt-gtcacgcctcagattttacgtttcattttcttgttttgcaggttgtgatcc |
126 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||| || ||||||| | ||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36612068 |
tgggggagttgcgcaattctgtgaataatttcttagtccagtgacggtagtcacgccttagattttacgtttcattttattgttttgcaggttgtgatcc |
36611969 |
T |
 |
| Q |
127 |
ttcagtcatc |
136 |
Q |
| |
|
|||||||||| |
|
|
| T |
36611968 |
ttcagtcatc |
36611959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 7417798 - 7417857
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7417798 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
7417857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 8400855 - 8400914
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8400855 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
8400914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 22855888 - 22855946
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22855888 |
cgagagaacccaggttcgagccccgctagtgtctttggagggaggtaaatgtaattacc |
22855946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 32893846 - 32893797
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataatt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32893846 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataatt |
32893797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 76 - 148
Target Start/End: Original strand, 32893717 - 32893789
Alignment:
| Q |
76 |
gtcacgcctcagattttacgtttcattttcttgttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
|||||||||||| |||||| | | |||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
32893717 |
gtcacgcctcaggttttacttgttattttcttgttttgcaggttatgatccttcagtcatccgcaaacaacaa |
32893789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 50823698 - 50823757
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50823698 |
ccgagagaatccgggttcgagtcccgttagtgcctttggagggaggtaaatgtaattacc |
50823757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 50852162 - 50852103
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50852162 |
ccgagagaatccgggttcgagtcccgttagtgcctttggagggaggtaaatgtaattacc |
50852103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 35198765 - 35198824
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||| |||||||||||||||| |||| |
|
|
| T |
35198765 |
ccgagagaacccgggttcgagccccactaatgcctttgcagggaggtaaatgtaaatacc |
35198824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 651 - 705
Target Start/End: Complemental strand, 43334186 - 43334132
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
43334186 |
ccgagagaacccgagttcgagccccgctagtgtcttgggagggaggtaaatgtaa |
43334132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 652 - 710
Target Start/End: Original strand, 55468000 - 55468058
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
55468000 |
cgagagaatccgggttcgagccccactaatgcgtttggagggaggtaaatgtaaatacc |
55468058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 651 - 708
Target Start/End: Original strand, 34824556 - 34824613
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaatta |
708 |
Q |
| |
|
||||||||||| | ||||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
34824556 |
ccgagagaacctgagttcgagtcccgttagtgcctttgaagggaggtaaatgtaatta |
34824613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 652 - 705
Target Start/End: Complemental strand, 48078072 - 48078019
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
48078072 |
cgagagaactcgggttcgagcctcactagtgcctttggaggaaggtaaatgtaa |
48078019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 666 - 710
Target Start/End: Original strand, 29635883 - 29635927
Alignment:
| Q |
666 |
ttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29635883 |
ttcgagcctcgctagtgcctttgaagggaggtaaatgtaattacc |
29635927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 662 - 705
Target Start/End: Original strand, 52545332 - 52545375
Alignment:
| Q |
662 |
cgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52545332 |
cgggttcgagccccgctagtgcctttaaagggaggtaaatgtaa |
52545375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 8878929 - 8878855
Alignment:
| Q |
13 |
gaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcag |
87 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||| ||||||| || |||||||||| | |||||||||||| |
|
|
| T |
8878929 |
gaacctgttgtattctgggggaattgcgcaatcttgctgataattgtttagttcagtgacgtagtcacgcctcag |
8878855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 651 - 709
Target Start/End: Complemental strand, 50726129 - 50726071
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| ||||||||| |||||||| ||||||| |
|
|
| T |
50726129 |
ccgagagaattcgggttcgagccccgttagtgtctttggaggaaggtaaatataattac |
50726071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 651 - 709
Target Start/End: Original strand, 50786719 - 50786777
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| ||||||||| |||||||| ||||||| |
|
|
| T |
50786719 |
ccgagagaattcgggttcgagccccgttagtgtctttggaggaaggtaaatataattac |
50786777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 680 - 710
Target Start/End: Complemental strand, 22371832 - 22371802
Alignment:
| Q |
680 |
gtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22371832 |
gtgcctttggagggaggtaaatgtaattacc |
22371802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 87; Significance: 2e-41; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 8 - 148
Target Start/End: Original strand, 40254861 - 40254998
Alignment:
| Q |
8 |
gagatgaacctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcagattttacgtttcattttctt |
107 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |||||||||||| |||||||||||| ||||||||| |||||||||| ||||| || |
|
|
| T |
40254861 |
gagatgaacctgttgtactatggaggagttgcgcaattctgtggataattccttagttcagtgacatagtcacgcct---gttttacgttttattttatt |
40254957 |
T |
 |
| Q |
108 |
gttttgcaggttgtgatccttcagtcatccgcgaacaacaa |
148 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40254958 |
attttacaggttgtgatccttcagtcatccgcgaacaacaa |
40254998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 26050014 - 26050140
Alignment:
| Q |
15 |
acctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctca-gatttta-cgtttcattttcttgtttt |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| || ||||||| | ||||||||||| | ||||| | ||| | ||| |||||| |
|
|
| T |
26050014 |
acctgttgtattctgggggagttgcgcaattctgcggataattccttagtccagtgacttagtcacgcctcagggttttacctttttagtttactgtttt |
26050113 |
T |
 |
| Q |
113 |
gcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
26050114 |
gcaggttgtgatacttcagtcatccgc |
26050140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 26053428 - 26053554
Alignment:
| Q |
15 |
acctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctca-gatttta-cgtttcattttcttgtttt |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||| || ||||||| | ||||||||||| | ||||| | ||| | ||| |||||| |
|
|
| T |
26053428 |
acctgttgtattctgggggagttgcgcaattctacggataattccttagtccagtgacttagtcacgcctcagggttttacctttttagtttactgtttt |
26053527 |
T |
 |
| Q |
113 |
gcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
26053528 |
gcaggttgtgatacttcagtcatccgc |
26053554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 651 - 710
Target Start/End: Original strand, 17064323 - 17064382
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17064323 |
ccgagagaacccgggttcgagcctcgctagtgcctttggagggaggtaaatgtaaatacc |
17064382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 654 - 709
Target Start/End: Complemental strand, 20983132 - 20983077
Alignment:
| Q |
654 |
agagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattac |
709 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
20983132 |
agagaatccgggttcgagccccgctagtgccttcggagagaggtaaatgcaattac |
20983077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 651 - 701
Target Start/End: Original strand, 37976546 - 37976596
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaat |
701 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
37976546 |
ccgagagaacctgggttcgagccccgctagtgcatttgaagggaggtaaat |
37976596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 652 - 703
Target Start/End: Complemental strand, 35237154 - 35237103
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgt |
703 |
Q |
| |
|
|||||||| | || ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
35237154 |
cgagagaatctggattcgagccccgctagtgtctttgaagggaggtaaatgt |
35237103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 27074981 - 27075107
Alignment:
| Q |
15 |
acctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctcaga-ttttacgtttc-attttcttgtttt |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| || ||||||| | |||||||||||| |||||| ||| | ||| ||||||| |
|
|
| T |
27074981 |
acctgttgtattctgggggagttgcgcaattctgcggataattccttagtccagtgacttagtcacgcctcagggttttacctttttagtttattgtttt |
27075080 |
T |
 |
| Q |
113 |
gcaggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
27075081 |
gcaggttgtgatacttcagtcatccgc |
27075107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 8e-26
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 27078346 - 27078470
Alignment:
| Q |
17 |
ctgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctca-gatttta-cgtttcattttcttgttttgc |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| || ||||||| | ||||||||||| | ||||| | ||| | ||| |||||||| |
|
|
| T |
27078346 |
ctgttgtattctgggggagttgcgcaattctgcggataattccttagtccagtgacttagtcacgcctcagggttttacctttttagtttactgttttgc |
27078445 |
T |
 |
| Q |
115 |
aggttgtgatccttcagtcatccgc |
139 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
27078446 |
aggttgtgatacttcagtcatccgc |
27078470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 651 - 705
Target Start/End: Original strand, 14496352 - 14496406
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaa |
705 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14496352 |
ccgagagaacccgggttcgagccccactagtgcctttggagggaggtaaatgtaa |
14496406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 653 - 710
Target Start/End: Complemental strand, 19686957 - 19686900
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
19686957 |
gagagaacctgggttcgagcccctctagtgcctttgtagggaggtaaatgtaattacc |
19686900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 35163882 - 35163823
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
35163882 |
ccgagagaaccagggttcgagccccactaatgcctttggagggaggtaaatgtaaatacc |
35163823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 651 - 706
Target Start/End: Complemental strand, 14505655 - 14505600
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaat |
706 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14505655 |
ccgagagatcccgaattcgagccccgctagtgcttttggagggaggtaaatgtaat |
14505600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 672 - 710
Target Start/End: Original strand, 20685346 - 20685384
Alignment:
| Q |
672 |
ccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20685346 |
ccccgctagtgcctttggagggaggtaaatgtaattacc |
20685384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 651 - 710
Target Start/End: Complemental strand, 2711866 - 2711807
Alignment:
| Q |
651 |
ccgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||| |||||| || |||||||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
2711866 |
ccgatagaacctggattcgagccccactagtgcttttggagggaggtaaatgtaaatacc |
2711807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 55; Significance: 3e-22; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 652 - 710
Target Start/End: Complemental strand, 107822 - 107764
Alignment:
| Q |
652 |
cgagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107822 |
cgagagaacccgagttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
107764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0691 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0691
Description:
Target: scaffold0691; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 653 - 710
Target Start/End: Complemental strand, 7099 - 7042
Alignment:
| Q |
653 |
gagagaacccgggttcgagccccgctagtgcctttggagggaggtaaatgtaattacc |
710 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7099 |
gagagaatccgggttcgagtcccgctagtgcgtttggagggaagtaaatgtaattacc |
7042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 206191 - 206259
Alignment:
| Q |
18 |
tgttgtactctgggggagttgcgcaattctgcggataattcctttgttcagtgacattgtcacgcctca |
86 |
Q |
| |
|
||||||| |||||||||||||||| ||| || |||||||||||| || || |||| | ||||||||||| |
|
|
| T |
206191 |
tgttgtattctgggggagttgcgctattatgtggataattccttagtccaatgacctagtcacgcctca |
206259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University