View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11709_low_6 (Length: 298)
Name: NF11709_low_6
Description: NF11709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11709_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 116 - 284
Target Start/End: Complemental strand, 35406152 - 35405984
Alignment:
| Q |
116 |
tgacttgttccaaggcttctgtggtaatagtattaatgataaagaagggaaaggttggtgagatgaattaattaaggtgttgctcagagactcttttgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406152 |
tgacttgttccaaggcttctgtggtaatagtattaatgataaagaagggaaaggttggtgagatgaattaattaaggtgttgctcagagactcttttgaa |
35406053 |
T |
 |
| Q |
216 |
ctttcagcatcaaatcatcattgtctgaatacgcatttgattcatgtattgatgatggtgcatgatatt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406052 |
ctttcagcatcaaatcatcattgtctgaatatgcatttgattcatgtattgatgatggtgcatgatatt |
35405984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 35406251 - 35406185
Alignment:
| Q |
17 |
aagaaagacaagaataagctagaaaaatgtgattttcatgtgcattaccatgctaaaacaccaacac |
83 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406251 |
aagaaagacaagaataaactagaaaaatgtgattttcatgtgcattaccatgctaaaacaccaacac |
35406185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University