View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11709_low_7 (Length: 270)
Name: NF11709_low_7
Description: NF11709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11709_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 23 - 260
Target Start/End: Complemental strand, 35166470 - 35166228
Alignment:
| Q |
23 |
tggctatgaatttggcaaaattctaaacaccaacccttcttgctggactgactgtgacatttgctttgcttctcccacattttggttgaatagtggacat |
122 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35166470 |
tggctatgaatttcgcaaaattctaaacaccaacccttcttgctggactgactgtgacatttgctttgcttctcccacattttgtttgaatagtggac-- |
35166373 |
T |
|
| Q |
123 |
aactatgactaggaagtag---gaactactactaa-------ataagccccaaacccataaattttgatgtatgaattaattttaaaattaattttaaat |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35166372 |
---tatgactaggaagtagtaggaactactactaattactaaataagccccaaacccataaattttgatgtatgaattaattttaaaattcattttaaat |
35166276 |
T |
|
| Q |
213 |
cacacagtcaagattcagccactgatgtactaaccaacaacttctctg |
260 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35166275 |
cacatagtcaagattcagccactgatgtactaaccaacaacttctctg |
35166228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University