View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_high_10 (Length: 384)
Name: NF1170_high_10
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 12 - 356
Target Start/End: Original strand, 33505208 - 33505551
Alignment:
| Q |
12 |
atgaataggagagtattaatattacgtactgtgcacatctagcaacaacatcctcagcaatggaggatagatacttgagcttcatcgccataaccgtttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33505208 |
atgaataggagagtattaatattacgtactgtgcacatctagcaacaacatcctcagcaatggaggatagatacttgagcttcatcgccataaccgtttg |
33505307 |
T |
 |
| Q |
112 |
tttgcagttaatttcttatttcctctcttgatctctttgatgctaagtaatatatatgagacaccgaaagggtgatacgtgggagggattagtaggtgcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33505308 |
tttgcagttaatttcttatttcctctcttgatctctttgatgctaagtaatatatatgagacaccgaaagggtgatacgtgggagggattagtaggtgcc |
33505407 |
T |
 |
| Q |
212 |
acgtgttaatagccatgcaacgcaagcatgcaacacgtacatggttatttgcctcctgcttaacnnnnnnnnnnncttttcggtaaaaggaatagaacaa |
311 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33505408 |
acgtgttaatagccatgcaatgcaagcatgcaacacgtacatggttatttgcctcctgcttaactttttttttttcttttcggtaaaaggaatagaacaa |
33505507 |
T |
 |
| Q |
312 |
taatatttcctgtttattaattcatcacatatatatctaatatct |
356 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33505508 |
taatatttcctg-ttattaattcatcacatatatatctaatatct |
33505551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University