View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1170_high_31 (Length: 219)

Name: NF1170_high_31
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1170_high_31
NF1170_high_31
[»] chr4 (1 HSPs)
chr4 (68-116)||(17478435-17478479)


Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 116
Target Start/End: Original strand, 17478435 - 17478479
Alignment:
68 atacctgttcttgcatagcctgcctgcacttgtttgttgtgctttgaca 116  Q
    |||||||||||||||||||||    ||||||||||||||||||||||||    
17478435 atacctgttcttgcatagcct----gcacttgtttgttgtgctttgaca 17478479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University