View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1170_high_32 (Length: 216)

Name: NF1170_high_32
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1170_high_32
NF1170_high_32
[»] chr7 (1 HSPs)
chr7 (19-205)||(36112269-36112455)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 36112455 - 36112269
Alignment:
19 tggtcgttatgaagcacatctatgggataaaagtacatggaatcaaaatcagaataagaaaggaaaacaaggtttgggctgttgaatacaagtcaggttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36112455 tggtcgttatgaagcacatctatgggataaaagtacatggaatcaaaatcagaataagaaaggaaaacaaggtttgggctgttgaatacaagtcaggttt 36112356  T
119 aaggttttgtgtaaagatgaaattgcttatgnnnnnnnnnnnngtgctgtgcatgaattgattgcccgggaattcgtgtctgtggtg 205  Q
    |||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||||||||||| |||||||    
36112355 aaggttttgtgtaaagatgaaattgcttatgttttttgtttttgtgctgtgcatgaattgattgcccgggaattcgtgtttgtggtg 36112269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University