View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_high_32 (Length: 216)
Name: NF1170_high_32
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 36112455 - 36112269
Alignment:
| Q |
19 |
tggtcgttatgaagcacatctatgggataaaagtacatggaatcaaaatcagaataagaaaggaaaacaaggtttgggctgttgaatacaagtcaggttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36112455 |
tggtcgttatgaagcacatctatgggataaaagtacatggaatcaaaatcagaataagaaaggaaaacaaggtttgggctgttgaatacaagtcaggttt |
36112356 |
T |
 |
| Q |
119 |
aaggttttgtgtaaagatgaaattgcttatgnnnnnnnnnnnngtgctgtgcatgaattgattgcccgggaattcgtgtctgtggtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36112355 |
aaggttttgtgtaaagatgaaattgcttatgttttttgtttttgtgctgtgcatgaattgattgcccgggaattcgtgtttgtggtg |
36112269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University