View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_19 (Length: 374)
Name: NF1170_low_19
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 81 - 279
Target Start/End: Original strand, 15180297 - 15180495
Alignment:
| Q |
81 |
cacagaaggaattaaagttcaaagtggccatgaaaccttcatatcaagtagttttcttggacaacactcaacagtcggcggagacaaaggcgaaagacaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15180297 |
cacagaaggaattaaagttcaaagtggccatgaaaccttcatatcaagtagttttcttggacaacactcaacagtcggtggagacaaaggcgaaagacaa |
15180396 |
T |
 |
| Q |
181 |
ttttcgggaactgcaattgatcttgctagcaacgacaatgctatcactgatgtcgcaattttctcagcagccattggaattgttgttaggggacaagct |
279 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15180397 |
ttttctggaactgcaattgatcttgctagcaatgacaatgctatcaccgatgtcgcaattttctcagcagccattggaattgttgttaggggacaagct |
15180495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 109 - 263
Target Start/End: Complemental strand, 38859568 - 38859414
Alignment:
| Q |
109 |
catgaaaccttcatatcaagtagttttcttggacaacactcaacagtcggcggagacaaaggcgaaagacaattttcgggaactgcaattgatcttgcta |
208 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||||||||||||| ||||| ||| | ||||| | | | ||| || | ||||||||||||| |
|
|
| T |
38859568 |
catgagacattcatatcaagttgttttcttggacaacactcaacagttggcggtgaccatggcgagaaggactattccggggtcggtattgatcttgcta |
38859469 |
T |
 |
| Q |
209 |
gcaacgacaatgctatcactgatgtcgcaattttctcagcagccattggaattgt |
263 |
Q |
| |
|
| || |||||||| |||||||||||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
38859468 |
gtaatgacaatgcaatcactgatgtcgcgattttctcggcagccactggtattgt |
38859414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University