View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_26 (Length: 324)
Name: NF1170_low_26
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 167 - 295
Target Start/End: Original strand, 47636561 - 47636689
Alignment:
| Q |
167 |
aaagacatgtaaattttaggaaggccaattccaaagatagagacgtgactaccgtatgattttacaacttggtgtctcaactctcaaactcatggctaac |
266 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47636561 |
aaagccatgtaaattttaggaaggccaattccaaagatagagacgtgactaccgtatgattttacaacttggtgtctcaactctcaaactcatggctaac |
47636660 |
T |
 |
| Q |
267 |
ctattacacgattaattgatagctcaact |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47636661 |
ctattacacgattaattgatagctcaact |
47636689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 16 - 86
Target Start/End: Original strand, 47636387 - 47636457
Alignment:
| Q |
16 |
atataagagagagctgtcctagaatgattgtgtaaatatcaatttctcatatgttgatgaaatgaatgacg |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47636387 |
atataagagagagctgtcctagaatgattgtgtaaatatcaatttctcatatgttaatgaaatgaatgacg |
47636457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 120 - 172
Target Start/End: Original strand, 47636456 - 47636508
Alignment:
| Q |
120 |
cgaattttcgaatttaatttctactcacaaacaagatcatatttaataaagac |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47636456 |
cgaattttcgaatttaatttctactcacaaacaagatcatatttaataaagac |
47636508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University