View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_29 (Length: 315)
Name: NF1170_low_29
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 72 - 301
Target Start/End: Original strand, 30918514 - 30918747
Alignment:
| Q |
72 |
acgaatccatcctcacatgacatttctgatatgtaagannnnnnnnnnnnnnaaaggaggattgtaaaaaatattattgaatttttccggtaagcttaac |
171 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30918514 |
acgaatccatccttacatgacatttctaatatgtaagatttttcttttttttaaaggaggattgtaaaaaatattattgaatttttccggtaagcttaac |
30918613 |
T |
|
| Q |
172 |
aaactggnnnnnnncattcgaggga----attcattcttgaacaaggcttcttgaggccaagtgtgtctatttgtatggctttatcttaatagatacaac |
267 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30918614 |
aaactggaaaaaaacattcgagggaattcattcattcttgaacaaggcttcttgaggccaagtgtgtctatttgtatggctttatcttaatagatacaac |
30918713 |
T |
|
| Q |
268 |
caaagaaaatacaggaaataaaatgtaccttgcc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30918714 |
caaagaaaatacaggaaataaaatgtaccttgcc |
30918747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 202 - 296
Target Start/End: Original strand, 52677377 - 52677470
Alignment:
| Q |
202 |
ttcttgaacaaggcttcttgaggccaagtgtgtctatttgtatggctttatcttaatagatacaaccaaagaaaatacaggaaataaaatgtacc |
296 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| || |||||||||||| || ||||| ||||| |||| |
|
|
| T |
52677377 |
ttcttgaacaaggcttcttgagggtaagtgtgtctgtttgtatggctttatcttaatag-tataaccaaagaaaacacgggaaacaaaatatacc |
52677470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University