View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1170_low_30 (Length: 313)

Name: NF1170_low_30

Description: NF1170

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1170_low_30

[»] chr3 (1 HSPs)

[»] chr6 (1 HSPs)

Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)

Name: chr3

Description:

Target: chr3; HSP #1

Raw Score: 79; E-Value: 6e-37

Query Start/End: Original strand, 37 - 182

Target Start/End: Complemental strand, 54451727 - 54451582

Alignment:

Q	37	ataatatatgcaaggttcagagattaaatttcggccaccatnnnnnnnttaagtcataaaaaagatactccatcccatcataaatataatcatatattcc	136	Q
		\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	54451727	ataatatatgtaaggttcaaagattaaattccggccaccataaaaaaattaagtcataaaaaagatactccatcccatcataaatataatcatatattcc	54451628	T

Q	137	acttttattnnnnnnnnnntttagtgtcgtctttattctaagagga	182	Q
		\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	54451627	acttttattaaaaaaaaatattagtgtcgtctttattctaagagga	54451582	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)

Name: chr6

Description:

Target: chr6; HSP #1

Raw Score: 32; E-Value: 0.000000007

Query Start/End: Original strand, 29 - 76

Target Start/End: Original strand, 28951422 - 28951469

Alignment:

Q	29	aacaatgtataatatatgcaaggttcagagattaaatttcggccacca	76	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|
T	28951422	aacaatgcataatatatgcaaggttcagagtttaaacctcggccacca	28951469	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]