View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_30 (Length: 313)
Name: NF1170_low_30
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 37 - 182
Target Start/End: Complemental strand, 54451727 - 54451582
Alignment:
| Q |
37 |
ataatatatgcaaggttcagagattaaatttcggccaccatnnnnnnnttaagtcataaaaaagatactccatcccatcataaatataatcatatattcc |
136 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54451727 |
ataatatatgtaaggttcaaagattaaattccggccaccataaaaaaattaagtcataaaaaagatactccatcccatcataaatataatcatatattcc |
54451628 |
T |
 |
| Q |
137 |
acttttattnnnnnnnnnntttagtgtcgtctttattctaagagga |
182 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54451627 |
acttttattaaaaaaaaatattagtgtcgtctttattctaagagga |
54451582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 29 - 76
Target Start/End: Original strand, 28951422 - 28951469
Alignment:
| Q |
29 |
aacaatgtataatatatgcaaggttcagagattaaatttcggccacca |
76 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
28951422 |
aacaatgcataatatatgcaaggttcagagtttaaacctcggccacca |
28951469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University