View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_35 (Length: 287)
Name: NF1170_low_35
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 272
Target Start/End: Original strand, 33259590 - 33259843
Alignment:
| Q |
19 |
aacaaagattctctcaactgatattccaacctcttttgatcatgttttgaatcttgaattattggaatccatagctgccccacaaggcacatggttaaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33259590 |
aacaaagattctctcaactgatattccaacctcttttgatcatgttttgaatcttgaattattggaatccatagctgccccacaaggcacatggttaaca |
33259689 |
T |
 |
| Q |
119 |
actcccctatggttgcttccttccaagtacgtggtatccaacacataattccgattggggctatcacatcatttcattttcacctatttttgtaaattac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33259690 |
actcccctatggttgcttccttccaagtacgtggtatccaacacataattccgattgggtctatcacatcatttcattttcacttatttttgtaaattac |
33259789 |
T |
 |
| Q |
219 |
atcacaataatatgtcacaaattttgacattaacccatgaactccgtgtttcat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33259790 |
atcacaataatatgtcacaaattttgacattaacccatgaactccgtgtttcat |
33259843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University