View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_46 (Length: 254)
Name: NF1170_low_46
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 5188274 - 5188496
Alignment:
| Q |
7 |
tccaacaatatcttagagggagaccaacccattcgataacttcactattatttttctttcttcttccnnnnnnnnnnctccactattattgttggcatct |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5188274 |
tccaaaaatatcttagagggagaccaacc-attcgataacttcactattatttttctttcttcttccaaaaaaaaaactccactattattgttggcatct |
5188372 |
T |
 |
| Q |
107 |
actatttgctaaaagaatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatatta |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5188373 |
actatttgctaaaaggatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatatta |
5188472 |
T |
 |
| Q |
207 |
tgtcatcggaatattccttgtacc |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5188473 |
tgtcatcggaatattccttgtacc |
5188496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University