View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_48 (Length: 251)
Name: NF1170_low_48
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 241
Target Start/End: Original strand, 17775496 - 17775714
Alignment:
| Q |
13 |
aatatcaaaagtggatttgtgtgtgatagtgtcccaattctgtttggttcttaatgaattgcatattaaggtgacaatgttgttgtttgtggaatgtgag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17775496 |
aatatcaaaagtggatttgtgtgtgatagtgtcccaattctgtttggttcttaatgaattgcatgttaaggtgacaatgttgttgtttgtggaatgtgag |
17775595 |
T |
|
| Q |
113 |
ttgagtctgcttaacagctccaggtgtttggaggaactagaactcattttcggtgtctctctcgacaagtatgcgtatggttgagtcaataagcccttca |
212 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
17775596 |
ttgactctgcttaacagctccaggtgt----------tagaactcattttcggtgtctctctcgacaagtatgtgtatggttgagtcaataagccctgca |
17775685 |
T |
|
| Q |
213 |
gtctttacgttatttaaccaatgaattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17775686 |
gtctttacgttatttaaccaatgaattat |
17775714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 13702716 - 13702774
Alignment:
| Q |
21 |
aagtggatttgtgtgtgatagtgtcccaattctgtttggttcttaatgaattgcatatt |
79 |
Q |
| |
|
||||| |||||||||||||||||||||| || ||||| ||||| ||||||||| ||||| |
|
|
| T |
13702716 |
aagtgaatttgtgtgtgatagtgtcccagttttgttttgttctgaatgaattggatatt |
13702774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University