View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1170_low_57 (Length: 209)
Name: NF1170_low_57
Description: NF1170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1170_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 38 - 189
Target Start/End: Original strand, 40985365 - 40985516
Alignment:
| Q |
38 |
atgaacaaactcacagaaatacaagaaataagacagacaaacaagaagcatgggaccacaaaaggtaatcacctgaaataatatgatcactcttagctta |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40985365 |
atgaacaaactcacagaaatacaagaaataagacagacaaacaagaagcatgggaccacaaaaggtaatcacctgaaataatatgatcactcttagctta |
40985464 |
T |
 |
| Q |
138 |
cgactttgagcttcaaaaaggatcttttcaagaagtttcaattttccacttg |
189 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40985465 |
cgacttttagcttcaaaaaggatcttttcaagaagttgcaattttccacttg |
40985516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University