View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11710_low_9 (Length: 226)
Name: NF11710_low_9
Description: NF11710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11710_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 45549001 - 45549215
Alignment:
| Q |
1 |
catagccgcaatctaatatcagcttgctactttggtcttgactgtcttgatgattaccttgaagaataccaaacgggatgtttagtctgaaaagtgcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45549001 |
catagccgcaatctaatatcagcttgctacgttggtcttgactgtcttgatgattaccttgaagaataccgaacgggatgtttagtctgaaaagtgcttc |
45549100 |
T |
|
| Q |
101 |
tgcagtgttgacgaataattgactcgtgaccaaaatccacttgaggtggttttcactttctgttagtggttgttggatgctcatcttttgattttgttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45549101 |
tgcagtgttgacgaataattgactcgtgaccaaaatccacttgaggtggttttcactttctgttagtggttgttggatgctcatattttgattttgttgt |
45549200 |
T |
|
| Q |
201 |
ttcacacccattctg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45549201 |
ttcacacccattctg |
45549215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University