View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11711_high_7 (Length: 279)
Name: NF11711_high_7
Description: NF11711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11711_high_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 279
Target Start/End: Original strand, 42239990 - 42240251
Alignment:
| Q |
16 |
gacatcaagttgagagagatatttttgttcctttcatattcatatgaaatatcttagttttgattctatcnnnnnnnnngatatcttaatgttggaccat |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42239990 |
gacatgaagttgagagagatatttttgttcctttcatattcatatgaaatatcttagttttgattctatcaaaaaaaa-gatatcttaatgttggaccat |
42240088 |
T |
|
| Q |
116 |
atatattgcattttgnnnnnnnnnnnnnnnngggcatgcgtcagctcatagttttgtgacgtcaaagacaattaaataaaaagaatggtttcatagacac |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240089 |
atatattgcattttgtttattatttttttt-gggcatgcgtcagttcatagttttgtgacgtcaaagacaattaaataaaaagaatggtttcatagacac |
42240187 |
T |
|
| Q |
216 |
aataagcaaaacacnnnnnnngtgatgcaacaacaagaatggaagttttcagtgggaaggaaaa |
279 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
42240188 |
aataagcaaaacacaacaaaagtgatgcaacaacaagaatggaggttttcagtaggaaggaaaa |
42240251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University