View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11711_low_12 (Length: 215)
Name: NF11711_low_12
Description: NF11711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11711_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 36790606 - 36790802
Alignment:
| Q |
16 |
tctttaacactgttactagtatcaatgtctcttttgcctttgatagnnnnnnnnnnnnnnnngtagtatctatatgttattaaataaatgcataagaaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36790606 |
tctttaacactgttactagtatcaatgtctcttttgcctttgatagaaaaataaaaaaa---gtagtatctatatgttattaaataaatgcataagaaac |
36790702 |
T |
 |
| Q |
116 |
tatgatagttttgcataagtgatgtttaggtgagtgaagaagcagcagcaagccaagtcccacatcgcacaaccnnnnnnngttttcgctgttattcaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36790703 |
tatgatagttttgcataagtgatgtttaggtgagtgaagaagcagcagcaagccaagtcccacatcgcacaaccaacaaaagttttcgctgttattcaat |
36790802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University