View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11711_low_9 (Length: 281)
Name: NF11711_low_9
Description: NF11711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11711_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 28 - 270
Target Start/End: Complemental strand, 42240485 - 42240251
Alignment:
| Q |
28 |
atggtagtactatttagtatttattgaagagaaataaccaaatagcagttaccagttaaataatgtcaatttgaaatataaaatctaatacaaacaaaac |
127 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240485 |
atggtagtaatatttagtatttattgaagagaaataaccaaatagcagttaccagttaaataatgtcaatttgaaatataaaatctaatacaaacaaaac |
42240386 |
T |
|
| Q |
128 |
taaaacctactacctaaactcttaggccttatattacctgaaccatattagatgatcaacttcatttgttatgtcactgcctcagcttgacacata--aa |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| || |
|
|
| T |
42240385 |
taaaacctactacctaaactcttaggccttatattacctgaaccatattagatgatcaacttcatttgt----------cctcagcatgacacataataa |
42240296 |
T |
|
| Q |
226 |
ttaatcttaatctcttctcattcaactatccaatccaatttctct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240295 |
ttaatcttaatctcttctcattcaactatccaatccaatttctct |
42240251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University